| CARD ID | 1446 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(T1r3-WGA)266Abek | |
| Internal Code | TIR3-WGA#266 | |
| Submitter | - - | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Graduate School of Agricultural and Life Sciences, The University of Tokyo |
| Organization code | 不明 | |
| Developer | Keiko Abe | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | WGA |
| Gene name | wheat germ agglutinin |
| Allele symbol | Tg(T1r3-WGA)266Abek |
| Allele name | transgene insertion 266, Keiko Abe |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| T1R3-F1 | AGCAGAACAGCTGAGACCCTTGC |
| WGA-R1 | CGTAAGGGCCATGGTGCTCATCATCTTTCT |
| Author | Makoto Ohmoto, Ichiro Matsumoto, Akihito Yasuoka, Yoshihiro Yoshihara, Keiko Abe |
| Title | Genetic tracing of the gustatory and trigeminal neural pathways originating from T1R3-expressing taste receptor cells and solitary chemoreceptor cells |
| Journal | Molecular and Cellular Neuroscience |
| Volume | 38 |
| Page | 505-517 |
| Year | 2008 |
| PMID |
| Disease name, Applicable field | Physiology, Anatomy, Neurobiology |